Mature sequence osa-miR166m

Accession numberMIMAT0001087
IDosa-miR166m
Stem-Loop osa-MIR166m
Sequence
ucggaccaggcuucauucccu
Get sequence
Deep sequencing36263 reads, 2 experiments
Database links
QuickGO function

References

1