Mature sequence osa-miR166g-3p

Accession numberMIMAT0001072
IDosa-miR166g-3p
Previous IDsosa-miR166g
Stem-Loop osa-MIR166g
Sequence
ucggaccaggcuucauuccuc
Get sequence
Deep sequencing36878 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).