Mature sequence osa-miR169l

Accession numberMIMAT0001057
IDosa-miR169l
Stem-Loop osa-MIR169l
Sequence
uagccaaggaugacuugccug
Get sequence
Deep sequencing5620 reads, 2 experiments
Database links
QuickGO function

References

1