Mature sequence osa-miR169c

Accession numberMIMAT0001048
IDosa-miR169c
Stem-Loop osa-MIR169c
Sequence
cagccaaggaugacuugccgg
Get sequence
Deep sequencing5707 reads, 2 experiments
Database links
QuickGO function

References

1