Mature sequence osa-miR164d

Accession numberMIMAT0001034
IDosa-miR164d
Stem-Loop osa-MIR164d
Sequence
uggagaagcagggcacgugcu
Get sequence
Deep sequencing3484 reads, 2 experiments
Database links
QuickGO function

References

1