Mature sequence osa-miR164c

Accession numberMIMAT0001033
IDosa-miR164c
Stem-Loop osa-MIR164c
Sequence
uggagaagcaggguacgugca
Get sequence
Deep sequencing2821 reads, 2 experiments
Database links
QuickGO function

References

1