Mature sequence osa-miR159b

Accession numberMIMAT0001023
IDosa-miR159b
Stem-Loop osa-MIR159b
Sequence
uuuggauugaagggagcucug
Get sequence
Deep sequencing2239 reads, 2 experiments
Database links
QuickGO function

References

1