Mature sequence rno-miR-299a-5p

Accession numberMIMAT0000901
IDrno-miR-299a-5p
Previous IDsrno-miR-299
Stem-Loop rno-mir-299a
Sequence
ugguuuaccgucccacauacau
Get sequence
Deep sequencing5773 reads, 276 experiments
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).