Mature sequence rno-miR-216a-5p

Accession numberMIMAT0000886
IDrno-miR-216a-5p
Previous IDsrno-miR-216;rno-miR-216a
Stem-Loop rno-mir-216a
Sequence
uaaucucagcuggcaacuguga
Get sequence
Deep sequencing218039 reads, 234 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).