Mature sequence rno-miR-205

Accession numberMIMAT0000878
IDrno-miR-205
Stem-Loop rno-mir-205
Sequence
uccuucauuccaccggagucugu
Get sequence
Deep sequencing150151 reads, 469 experiments
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).