Mature sequence rno-miR-143-3p

Accession numberMIMAT0000849
IDrno-miR-143-3p
Previous IDsrno-miR-143
Stem-Loop rno-mir-143
Sequence
ugagaugaagcacuguagcuca
Get sequence
Deep sequencing197575912 reads, 504 experiments
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).