Mature sequence hsa-miR-346

Accession numberMIMAT0000773
IDhsa-miR-346
Stem-Loop hsa-mir-346
Sequence
ugucugcccgcaugccugccucu
Get sequence
Deep sequencing857 reads, 96 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2