Mature sequence hsa-miR-325

Accession numberMIMAT0000771
IDhsa-miR-325
Stem-Loop hsa-mir-325
Sequence
ccuaguagguguccaguaagugu
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2