Mature sequence cel-miR-392-3p

Accession numberMIMAT0000768
IDcel-miR-392-3p
Previous IDscel-miR-392
Stem-Loop cel-mir-392
Sequence
uaucaucgaucacgugugauga
Get sequence
Deep sequencing120 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4