Mature sequence hsa-miR-323a-3p

Accession numberMIMAT0000755
IDhsa-miR-323a-3p
Previous IDshsa-miR-323;hsa-miR-323-3p
Stem-Loop hsa-mir-323a
Sequence
cacauuacacggucgaccucu
Get sequence
Deep sequencing3109 reads, 112 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).