Mature sequence hsa-miR-340-3p

Accession numberMIMAT0000750
IDhsa-miR-340-3p
Previous IDshsa-miR-340;hsa-miR-340*
Stem-Loop hsa-mir-340
Sequence
uccgucucaguuacuuuauagc
Get sequence
Deep sequencing9260 reads, 136 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).