Mature sequence hsa-miR-302b-3p

Accession numberMIMAT0000715
IDhsa-miR-302b-3p
Previous IDshsa-miR-302b
Stem-Loop hsa-mir-302b
Sequence
uaagugcuuccauguuuuaguag
Get sequence
Deep sequencing817 reads, 30 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).