Mature sequence cel-miR-354-3p

Accession numberMIMAT0000696
IDcel-miR-354-3p
Previous IDscel-miR-354
Stem-Loop cel-mir-354
Sequence
accuuguuuguugcugcuccu
Get sequence
Deep sequencing4 reads, 4 experiments
Predicted targets

References

1