Mature sequence hsa-miR-30e-5p

Accession numberMIMAT0000692
IDhsa-miR-30e-5p
Previous IDshsa-miR-30e-5p;hsa-miR-30e
Stem-Loop hsa-mir-30e
Sequence
uguaaacauccuugacuggaag
Get sequence
Deep sequencing6647321 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).