Mature sequence hsa-miR-34c-5p

Accession numberMIMAT0000686
IDhsa-miR-34c-5p
Previous IDshsa-miR-34c
Stem-Loop hsa-mir-34c
Sequence
aggcaguguaguuagcugauugc
Get sequence
Deep sequencing204545 reads, 131 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).