Mature sequence osa-miR166f

Accession numberMIMAT0000640
IDosa-miR166f
Stem-Loop osa-MIR166f
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing36912 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).