Mature sequence rno-miR-352

Accession numberMIMAT0000610
IDrno-miR-352
Stem-Loop rno-mir-352
Sequence
agaguaguagguugcauagua
Get sequence
Deep sequencing1144 reads, 298 experiments
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).