Mature sequence cbr-miR-252

Accession numberMIMAT0000507
IDcbr-miR-252
Stem-Loop cbr-mir-252
Sequence
uaaguaguagugccgcagguaac
Get sequence
Deep sequencing reads, experiments

References