Mature sequence hsa-miR-195-5p

Accession numberMIMAT0000461
IDhsa-miR-195-5p
Previous IDshsa-miR-195
Stem-Loop hsa-mir-195
Sequence
uagcagcacagaaauauuggc
Get sequence
Deep sequencing125848 reads, 77 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).