Mature sequence hsa-miR-9-3p

Accession numberMIMAT0000442
IDhsa-miR-9-3p
Previous IDshsa-miR-9*
Stem-Loop hsa-mir-9-1 hsa-mir-9-2 hsa-mir-9-3
Sequence
auaaagcuagauaaccgaaagu
Get sequence
Deep sequencing266091 reads, 137 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).