Mature sequence hsa-miR-125b-5p

Accession numberMIMAT0000423
IDhsa-miR-125b-5p
Previous IDshsa-miR-125b
Stem-Loop hsa-mir-125b-1 hsa-mir-125b-2
Sequence
ucccugagacccuaacuuguga
Get sequence
Deep sequencing932867 reads, 77 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7