Mature sequence dme-miR-289-5p

Accession numberMIMAT0000364
IDdme-miR-289-5p
Previous IDsdme-miR-289
Stem-Loop dme-mir-289
Sequence
uaaauauuuaaguggagccugcgacu
Get sequence
Deep sequencing2959 reads, 48 experiments
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).