Mature sequence dme-miR-33-5p

Accession numberMIMAT0000342
IDdme-miR-33-5p
Previous IDsdme-miR-33
Stem-Loop dme-mir-33
Sequence
gugcauuguagucgcauuguc
Get sequence
Deep sequencing564075 reads, 49 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).