Mature sequence hsa-miR-219a-5p

Accession numberMIMAT0000276
IDhsa-miR-219a-5p
Previous IDshsa-miR-219
Stem-Loop hsa-mir-219a-1 hsa-mir-219a-2
Sequence
ugauuguccaaacgcaauucu
Get sequence
Deep sequencing3742 reads, 132 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).