Mature sequence hsa-miR-211-5p

Accession numberMIMAT0000268
IDhsa-miR-211-5p
Previous IDshsa-miR-211
Stem-Loop hsa-mir-211
Sequence
uucccuuugucauccuucgccu
Get sequence
Deep sequencing63039 reads, 54 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).