Mature sequence hsa-miR-204-5p

Accession numberMIMAT0000265
IDhsa-miR-204-5p
Previous IDshsa-miR-204
Stem-Loop hsa-mir-204
Sequence
uucccuuugucauccuaugccu
Get sequence
Deep sequencing84706 reads, 143 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).