Mature sequence hsa-miR-147a

Accession numberMIMAT0000251
IDhsa-miR-147a
Previous IDshsa-miR-147
Stem-Loop hsa-mir-147a
Sequence
guguguggaaaugcuucugc
Get sequence
Deep sequencing1732 reads, 108 experiments
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).