Mature sequence hsa-miR-30d-5p

Accession numberMIMAT0000245
IDhsa-miR-30d-5p
Previous IDshsa-miR-30d
Stem-Loop hsa-mir-30d
Sequence
uguaaacauccccgacuggaag
Get sequence
Deep sequencing7750434 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).