Mature sequence ath-miR172b-3p

Accession number MIMAT0000205
ID ath-miR172b-3p
Previous IDs ath-miR172b
Sequence 
agaaucuugaugaugcugcau
Get sequence
Stem-Loop ath-MIR172b

References

1
PMID:12225663 "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" Park W, Li J, Song R, Messing J, Chen X Curr Biol. 12:1484-1495(2002).
2
PMID:12226481 "Short RNAs can identify new candidate transposable element families in Arabidopsis" Mette MF, van der Winden J, Matzke M, Matzke AJ Plant Physiol. 130:6-9(2002).
3
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
4
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
5
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
7
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).