Mature sequence hsa-miR-33a-5p

Accession numberMIMAT0000091
IDhsa-miR-33a-5p
Previous IDshsa-miR-33;hsa-miR-33a
Stem-Loop hsa-mir-33a
Sequence
gugcauuguaguugcauugca
Get sequence
Deep sequencing114287 reads, 156 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).