Deep sequencing reads for mature sequence MIMAT0022723

Stem-loop ID hsa-mir-548h-4
Mature ID hsa-miR-548h-3p
Reads 
               hsa-miR-548h-5p                                       hsa-miR-548h-3p                             Count     RPM (mean number of reads per million)
...............CAAAAGUAAUCGCGGUUUUUGU..........................................................................  2         0.04
................AAAAGUAAUCGCGGUUUUUGU..........................................................................  10        0.2
................AAAAGUAAUCGCGGUUUUUGUC.........................................................................  9         0.18
................AAAAGUAAUCGCGGUUUUUG...........................................................................  2         0.04
................AAAAGUAAUCGCGGUUUUUGUCA........................................................................  2         0.04
........................................................................AAAACCGCAAUUACUUUUGCACC................  1         5.79
.........................................................................AAACCGCAAUUACUUUUGCACCA...............  1         10.1
.........................................................................AAACCGCAAUUACUUUUGCACCAAC.............  1         3.94
.........................................................................AAACCGCAAUUACUUUUGCACCAA..............  1         3.77
GCUAUUAGGUUGGUGCAAAAGUAAUCGCGGUUUUUGUCAUUACUUUAAUUACUUUACGUUUCAUUAAUGACAAAAACCGCAAUUACUUUUGCACCAACCUAAUACUUGCUA
(((((((((((((((((((((((((.((((((((((((((((....(((........)))....)))))))))))))))).)))))))))))))))))))))))...)).. (-59.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 3embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 6melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000105 36 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 6melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 4melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 3melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000149 1 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000155 4 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 5 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 1 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 8 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 2 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 2 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 1 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000185 4 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 2 GEO : GSM532923 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).