Deep sequencing reads for mature sequence MIMAT0022721

Stem-loop ID hsa-mir-1247
Mature ID hsa-miR-1247-3p
Reads 
                                      hsa-miR-1247-5p                    hsa-miR-1247-3p                                                   Count     RPM (mean number of reads per million)
......................................CACCCGUCCCGUUCGUCCCCGGA...........................................................................  2         0.657
.......................................ACCCGUCCCGUUCGUCCCCGGA...........................................................................  12        5.97
.........................................................................CCCCGGGAACGUCGAGACUGGAGC.......................................  43        560
.........................................................................CCCCGGGAACGUCGAGACUGGAG........................................  8         82
.........................................................................CCCCGGGAACGUCGAGACUG...........................................  1         8.39
..........................................................................CCCGGGAACGUCGAGACUGGAGC.......................................  1         18.3
............................................................................CGGGAACGUCGAGACUGGAGC.......................................  10        4.63
............................................................................CGGGAACGUCGAGACUGGAG........................................  3         1.44
CCGCUUGCCUCGCCCAGCGCAGCCCCGGCCGCUGGGCGCACCCGUCCCGUUCGUCCCCGGACGUUGCUCUCUACCCCGGGAACGUCGAGACUGGAGCGCCCGAACUGAGCCACCUUCGCGGACCCCGAGAGCGGCG
.((((.((((((.((.(((.((....(((((.(((((((.((.(((.((..(((.(((((..((........)).))))).))).)).))).)).)))))))...)).)))..)).)))))....)))).)))))) (-57.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 11embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 28embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000135 4 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000140 1squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000141 1 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000157 2 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 24 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000164 1squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 51 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 35 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 8 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000175 1 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000181 53 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 13whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).