Deep sequencing reads for mature sequence MIMAT0021091

Stem-loop ID osa-MIR5146
Mature ID osa-miR5146
Reads 
                                                      osa-miR5146                     Count     RPM (mean number of reads per million)
.........................................................AAUGAACCGGCACCUAUACUUCGU...  24        7.54
UAUAGGUGCUGGUUCUUAAAAAAACCGAUACCUAUAGUAUUUGUACCGGUUUUAACUAAUGAACCGGCACCUAUACUUCGUAAA
((((((((((((((((((..(((((((.(((...........))).)))))))...))).)))))))))))))))......... (-33.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000009 1whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000201 67whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 45whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
2
PMID:21113019 "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)" Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).