Deep sequencing reads for mature sequence MIMAT0020631

Stem-loop ID

mmu-mir-466q

Mature ID

mmu-miR-466q

Reads

                                              mmu-miR-466q                    Count     RPM (mean number of reads per million)
......GUGUGUGUGUGUGUGUGUGU..................................................  2         0.391
.......UGUGUGUGUGUGUGUGUGUGU................................................  1         0.017
........GUGUGUGUGUGUGUGUG...................................................  2         0.225
...........UGUGUGUGUGUGUGUGUAUGU............................................  3         0.296
...........UGUGUGUGUGUGUGUGUAUG.............................................  1         0.183
...........UGUGUGUGUGUGUGUGUAUGUG...........................................  1         0.00422
.............UGUGUGUGUGUGUGUAUGUGU..........................................  4         0.145
............................................UGUGCACACACACACAUACGU...........  2         0.00567
............................................UGUGCACACACACACAUACGUA..........  1         0.00373
GUGUGUGUGUGUGUGUGUGUGUGUGUGUAUGUGUGUGUAGUAUAUGUGCACACACACACAUACGUACCCAUGCAUG
(((((((.(((((((((((((((((((((((((((.....))))))))))))))))))))))))))).))))))). (-44.60)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000034	2	testes	GEO : GSM510438		[ Chiang HR et al.]
ER0000000038	3	brain	GEO : GSM510442		[ Chiang HR et al.]
ER0000000039	1	brain	GEO : GSM510443		[ Chiang HR et al.]
ER0000000040	7	brain	GEO : GSM510444		[ Chiang HR et al.]
ER0000000043	2	whole body	GEO : GSM510447	Newborn.	[ Chiang HR et al.]
ER0000000044	1	whole body	GEO : GSM510448	Newborn.	[ Chiang HR et al.]
ER0000000045	7	whole body	GEO : GSM510449	Newborn.	[ Chiang HR et al.]
ER0000000046	9	whole body	GEO : GSM510450	Newborn.	[ Chiang HR et al.]
ER0000000047	7	whole body	GEO : GSM510451	Newborn.	[ Chiang HR et al.]
ER0000000048	1	whole body	GEO : GSM510452	Newborn.	[ Chiang HR et al.]
ER0000000049	7	whole body	GEO : GSM510453	Newborn.	[ Chiang HR et al.]
ER0000000050	3	whole body	GEO : GSM510454	Newborn.	[ Chiang HR et al.]
ER0000000051	3	whole body	GEO : GSM510455	Newborn.	[ Chiang HR et al.]
ER0000000052	30	whole body	GEO : GSM510456	Newborn.	[ Chiang HR et al.]
ER0000000055	5	embryo	GEO : GSM510459	day 12.5 embryo	[ Chiang HR et al.]
ER0000000059	5	embryo	GEO : GSM510463	day 9.5 embryo	[ Chiang HR et al.]
ER0000000060	4	embryo	GEO : GSM510464	day 9.5 embryo	[ Chiang HR et al.]
ER0000000063	7	embryo	GEO : GSM510467	day 7.5 embryo	[ Chiang HR et al.]
ER0000000218	4	spleen	GEO : GSM539837	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219	1	spleen	GEO : GSM539838	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220	1	spleen	GEO : GSM539839	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221	4	spleen	GEO : GSM539840	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222	2	spleen	GEO : GSM539841	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223	2	spleen	GEO : GSM539842	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224	2	spleen	GEO : GSM539843	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225	1	peritoneal lavage	GEO : GSM539844	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227	3	lymph nodes	GEO : GSM539846	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228	3	lymph nodes	GEO : GSM539847	strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229	1	bone marrow	GEO : GSM539848	strain: C57BL/6J, gender: male
ER0000000230	1	bone marrow	GEO : GSM539849	strain: C57BL/6J, gender: male
ER0000000231	3	bone marrow	GEO : GSM539850	strain: C57BL/6J, gender: male
ER0000000232	5	peritoneal lavage	GEO : GSM539851	strain: C57BL/6J, gender: male
ER0000000233	2	peritoneal lavage	GEO : GSM539852	strain: C57BL/6J, gender: male
ER0000000236	5	spleen	GEO : GSM539855	strain: RAG-/-, gender: male
ER0000000237	8	thymus	GEO : GSM539856
ER0000000238	4	spleen	GEO : GSM539857	strain: C57BL/6J, gender: male
ER0000000239	6	spleen	GEO : GSM539858	strain: C57BL/6J, gender: male
ER0000000240	4	spleen	GEO : GSM539859	strain: C57BL/6J, gender: male
ER0000000241	2	lymph nodes/spleen	GEO : GSM539860	strain: C57BL/6J, gender: male
ER0000000242	3	lymph nodes/spleen	GEO : GSM539861	strain: C57BL/6J, gender: male
ER0000000243	5	lymph nodes/spleen	GEO : GSM539862	strain: C57BL/6J, gender: male
ER0000000244	25	spleen	GEO : GSM539863	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245	1	lymph nodes/spleen	GEO : GSM539864	strain: C57BL/6J, gender: male
ER0000000246	2	lymph nodes/spleen	GEO : GSM539865	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247	2		GEO : GSM539866	strain: C57BL/6-129
ER0000000248	1		GEO : GSM539867	strain: C57BL/6J, developmental stage: E13.5
ER0000000255	2	skin	GEO : GSM539874	strain: C57BL/6J, gender: male
ER0000000257	2	salivary glands	GEO : GSM539876	strain: C57BL/6J, gender: male
ER0000000260	2	spleen	GEO : GSM539879	strain: BclXL transgenic BalbC, gender: male
ER0000000261	6	lymph nodes	GEO : GSM539880	strain: BclXL transgenic BalbC, gender: male

References

1. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).