Deep sequencing reads for mature sequence MIMAT0020136

Stem-loop ID cel-mir-4930
Mature ID cel-miR-4930
Reads 
                        cel-miR-4930                                                                            Count     RPM (mean number of reads per million)
......................GGCUGCCUAGGGGGCUGGCUAG..................................................................  1         6.37
GUCUGCCUAGGGGGCUGGCUAGGGCUGCCUAGGGGGCUGGCUAGGGCUGCCUAGGGGCUGGCUGCCUAGGGGCUGGCUAGGGCUGCCUAGGGGCUGGCUAGGGUAGGCUU
((((((((....(((..(((.((((.((((....(((..(((.((((.(((........))).))))...)))..))).)))).))))...)))..))).)))))))).. (-62.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000206 1adult GEO : GSM604035 strain: daf-2(e1379) mutant, age: Day 10 [ de Lencastre A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).