Deep sequencing reads for mature sequence MIMAT0020002

Stem-loop ID cel-mir-4814
Mature ID cel-miR-4814-5p
Reads
                 cel-miR-4814-5p                             cel-miR-4814-3p                           Count     RPM (mean number of reads per million)
..................UUCUCAACCAACUUUGGCCACU............................................................  1         1.39
..............................................................UGGGCAAAGUUGGUUGAGAAGU................  1         5.7
UAAACCAACUUUACCCACUUCUCAACCAACUUUGGCCACUUUUCAACUGCCAUUCACAGAAGUGGGCAAAGUUGGUUGAGAAGUGGGUAAAGUUGGGCAA
....((((((((((((((((((((((((((((((.((((((((..............)))))))).)))))))))))))))))))))))))))))).... (-66.04)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000204 1adult GEO : GSM604033 strain: N2 wild-type, age: Day 10 [ de Lencastre A et al.]
ER0000000212 1whole body GEO : GSM139137 mixed-stage [ Ruby JG et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).