Deep sequencing reads for mature sequence MIMAT0019705

Stem-loop ID hsa-mir-4645
Mature ID hsa-miR-4645-5p
Reads
       hsa-miR-4645-5p                      hsa-miR-4645-3p                    Count     RPM (mean number of reads per million)
UGAUAGGGAAACCAGGCAAGAAAUAUUGUCUCCUCAAGUUGCGACGAGACAGUAGUUCUUGCCUGGUUUCUCUAUCA
.(((((((((((((((((((((.(((((((((.((.......)).))))))))).))))))))))))))))))))). (-50.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000180 1squamous cell GEO : GSM532916 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2