Deep sequencing reads for mature sequence MIMAT0019079

Stem-loop ID hsa-mir-548an
Mature ID hsa-miR-548an
Reads 
              hsa-miR-548an                                                          Count     RPM (mean number of reads per million)
..................................................CAAAAACCGCAAUUCCUUUUGC...........  2         0.315
CAUUAGGUUGGUGCAAAAGGCAUUGUGGUUUUUGCCUAUAAAAGUAAUGGCAAAAACCGCAAUUCCUUUUGCACCAACCUAAU
.(((((((((((((((((((.(((((((((((((((............))))))))))))))).))))))))))))))))))) (-55.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000159 2 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000164 4squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).