Deep sequencing reads for mature sequence MIMAT0019027

Stem-loop ID hsa-mir-4492
Mature ID hsa-miR-4492
Reads 
                                                        hsa-miR-4492             Count     RPM (mean number of reads per million)
CUGCAGCGUGCUUCUCCAGGCCCCGCGCGCGGACAGACACACGGACAAGUCCCGCCAGGGGCUGGGCGCGCGCCAGCCGG
(.((.((((((...(((((.((((..(((.((((..............)))))))..))))))))).))))))..)).). (-36.74)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 1embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000103 2melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000140 2squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000144 2squamous cell GEO : GSM532880 [ Witten D et al.]
ER0000000151 4 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000156 5squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 1 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000164 3squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000168 3adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000169 2 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000175 1 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000181 1 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000186 3squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).