Deep sequencing reads for mature sequence MIMAT0019002

Stem-loop ID hsa-mir-4475
Mature ID hsa-miR-4475
Reads 
                                      hsa-miR-4475             Count     RPM (mean number of reads per million)
....................................CAAGGGACCAAGCAUUCAUUAU...  2         0.449
....................................CAAGGGACCAAGCAUUCAUUA....  2         0.505
AUCUCAAUGAGUGUGUGGUUCUAAAUGACUCAUAGUCAAGGGACCAAGCAUUCAUUAUGAA
.((..(((((((((.(((((((...((((.....)))).))))))).)))))))))..)). (-24.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000106 2melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 2melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).