Deep sequencing reads for mature sequence MIMAT0018934

Stem-loop ID hsa-mir-4421
Mature ID hsa-miR-4421
Reads 
                                            hsa-miR-4421               Count     RPM (mean number of reads per million)
..........................................ACCUGUCUGUGGAAAGGAGCUA.....  17        1.54
..........................................ACCUGUCUGUGGAAAGGAGCUAC....  6         0.614
..........................................ACCUGUCUGUGGAAAGGAGCU......  2         0.157
..........................................ACCUGUCUGUGGAAAGGAGC.......  2         0.103
...........................................CCUGUCUGUGGAAAGGAGCUAC....  20        1.73
...........................................CCUGUCUGUGGAAAGGAGCUA.....  6         0.417
CUGGGUCUCCUUUCUGCUGAGAGUUGAACACUUGUUGGGACAACCUGUCUGUGGAAAGGAGCUACCUAC
.(((((((((((((..(.((.(((((..(.(.....))..))).)).)).)..))))))))..))))). (-26.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 11 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 2melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000108 30melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 11melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 3melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).