Deep sequencing reads for mature sequence MIMAT0018803

Stem-loop ID tca-mir-29
Mature ID tca-miR-29-3p
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                                        tca-miR-29-5p                        tca-miR-29-3p                                           Count     RPM (mean number of reads per million)
.......................................ACUGUUUUCGUGUGGUGGU........................................................................  52        6.71
.......................................ACUGUUUUCGUGUGGUGGUGAG.....................................................................  44        5.67
.......................................ACUGUUUUCGUGUGGUGGUG.......................................................................  42        5.42
.......................................ACUGUUUUCGUGUGGUGG.........................................................................  34        4.38
.......................................ACUGUUUUCGUGUGGUGGUGA......................................................................  32        4.13
.......................................ACUGUUUUCGUGUGGUGGUGAGA....................................................................  6         0.774
.......................................ACUGUUUUCGUGUGGUGGUGAGAUU..................................................................  2         0.258
...........................................................................CUAGCACCAUAUGAAAUCAGUUC................................  2         0.258
...........................................................................CUAGCACCAUAUGAAAUC.....................................  2         0.258
............................................................................UAGCACCAUAUGAAAUCAGUUC................................  1790      363
............................................................................UAGCACCAUAUGAAAUCAG...................................  1102      175
............................................................................UAGCACCAUAUGAAAUCA....................................  348       53.1
............................................................................UAGCACCAUAUGAAAUCAGU..................................  254       65.7
............................................................................UAGCACCAUAUGAAAUCAGUU.................................  152       27.8
............................................................................UAGCACCAUAUGAAAUCAGUUCU...............................  22        2.84
............................................................................UAGCACCAUAUGAAAUCAGUUCUU..............................  8         1.03
............................................................................UAGCACCAUAUGAAAUCAGUUCUUG.............................  8         1.03
............................................................................UAGCACCAUAUGAAAUCAGUUCUUGU............................  2         0.258
.............................................................................AGCACCAUAUGAAAUCAGUUC................................  106       13.7
.............................................................................AGCACCAUAUGAAAUCAG...................................  36        4.64
.............................................................................AGCACCAUAUGAAAUCAGUU.................................  8         1.03
.............................................................................AGCACCAUAUGAAAUCAGU..................................  8         1.03
.............................................................................AGCACCAUAUGAAAUCAGUUCUU..............................  2         0.258
..............................................................................GCACCAUAUGAAAUCAGU..................................  2         0.258
UUUGUGGUGGAACAAUAGUUGUAGGAUUUGGCUUUGGGCACUGUUUUCGUGUGGUGGUGAGAUUUUAUUUUGAUUCUAGCACCAUAUGAAAUCAGUUCUUGUACCAAAUACCAGCGAAAUACACCAAGUG
....(((((.........((((.((((((((...((((.((((.((((((((((((.((..(((.......)))..)).)))))))))))).)))).))))..)))))).)).))))....))))).... (-43.62)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000199 7174Adult GEO : GSM639446 Genotype: Wild type; Gender: Male and female [ Marco A et al.]
ER0000000200 66Embryo GEO : GSM639447 Genotype: Wild type; Age: 0-5 days; Gender: Male and female [ Marco A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).