Deep sequencing reads for mature sequence MIMAT0018548

Stem-loop ID ame-mir-3772
Mature ID ame-miR-3772
Reads 
                                                                   ame-miR-3772                  Count     RPM (mean number of reads per million)
AAAAGGAGCUGGUGUUCCGGGUUCGAUUCCCAGGGCUGACUCGAGAAACGCCGCUUCCCUCGACCGAUCUAGAUUGAGAAGGAACGAAGGCGCCUA
...(((.(((..((((((...(((((((....((..((..(((((.............))))).))..)).)))))))..))))))..))).))). (-29.12)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000271 4whole body SRA : SRA012371 [ Chen X et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).