Deep sequencing reads for mature sequence MIMAT0018204

Stem-loop ID hsa-mir-676
Mature ID hsa-miR-676-3p
Reads
      hsa-miR-676-5p                     hsa-miR-676-3p              Count     RPM (mean number of reads per million)
.......UCUUCAACCUCAGGACUUGCA.......................................  4         1.01
..........................................CUGUCCUAAGGUUGUUGAGUU....  10        27
..........................................CUGUCCUAAGGUUGUUGAGUUGU..  3         0.761
..........................................CUGUCCUAAGGUUGUUGAGUUG...  2         0.508
GCAUGACUCUUCAACCUCAGGACUUGCAGAAUUAAUGGAAUGCUGUCCUAAGGUUGUUGAGUUGUGC
(((..((((..((((((.(((((..(((............))).))))).))))))..))))..))) (-31.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000110 12melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000114 6melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000262 2 GEO : GSM337570 antibody: anti-Ago1 4B8
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).