Deep sequencing reads for mature sequence MIMAT0018186

Stem-loop ID hsa-mir-3912
Mature ID hsa-miR-3912
Reads
                                                               hsa-miR-3912                               Count     RPM (mean number of reads per million)
...............................................................AACGCAUAAUAUGGACAUGUUA....................  2         0.24
AGAGAGGAAUGAACAGUUAAAUUAUAACAUGUCCAUAUUAUGGGUUAGUUGUGGACACAUACUAACGCAUAAUAUGGACAUGUUAUAAUUUAACUGUUCCUUUCU
((((((((....((((((((((((((((((((((((((((((.((((((.(((....))))))))).)))))))))))))))))))))))))))))))))))))) (-62.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000185 1 GEO : GSM532921 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2